Patent
Probe, probe set, probe carrier, and testing method
| العنوان: | Probe, probe set, probe carrier, and testing method |
|---|---|
| Patent Number: | 8,568,983 |
| تاريخ النشر: | October 29, 2013 |
| Appl. No: | 12/698074 |
| Application Filed: | February 01, 2010 |
| مستخلص: | A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 3 and mutated sequences thereof. |
| Inventors: | Tomatsu, Nobuhiro (Yokohama, JP); Fukui, Toshifumi (Yokohama, JP); Shimizu, Nobuyoshi (Sakura, JP); Takayanagi, Atsushi (Tokyo, JP) |
| Assignees: | Canon Kabushiki Kaisha (Tokyo, JP) |
| Claim: | 1. A method of specifically detecting the internal transcribed spacer (ITS) region of DNA of Candida tropicalis which is a pathogenic fungus, comprising: (i) reacting a sample with a probe carrier comprising the following three probes (A) to (C), which are immobilized on a carrier as arranged at intervals, under stringent conditions; and (ii) detecting a reaction intensity of each probe on the probe carrier reacted with a nucleic acid contained in the sample to detect the internal transcribed spacer (ITS) region of DNA of Candida tropicalis that reacts with all of the three probes: (A) a probe consisting of a base sequence represented by accgccagaggttataactaaaccaaa (SEQ ID NO. 1) or the fully complementary sequence thereof; (B) a probe consisting of a base sequence represented by gagcaatacgctaggtttgtttgaaagaa (SEQ ID NO. 2) or the fully complementary sequence thereof; and (C) a probe consisting of a base sequence represented by acgcttattttgctagtggccacc (SEQ ID NO. 3) or the fully complementary sequence thereof. |
| Claim: | 2. The method according to claim 1 , wherein the method uses a kit for specifically detecting the internal transcribed spacer (ITS) region of DNA of Candida tropicalis , the kit comprising: the probe carrier; and a reagent for detecting a reaction between each of the three probes with a target nucleic acid. |
| Claim: | 3. The method according to claim 1 , wherein the method specifically detects the internal transcribed spacer (ITS) region of DNA of Candida tropicalis , in a sample potentially containing Candida tropicalis , along with other Candida species, Trichosporon species, Cryptococcus species, Aspergillus species, Epidermophyton species, Arthroderma species, or Trichophyton species. |
| Claim: | 4. The method according to claim 3 , wherein the method specifically detects the internal transcribed spacer (ITS) region of DNA of Candida tropicalis , in a sample potentially containing Candida tropicalis , along with Candida albicans (JCM 1542), Candida dubliniensis (ATCC MYA-646), Candida glabrata (JCM 3761), Candida guilliermondii (ATCC 6260), Candida intermedia (ATCC 14439), Candida kefyr (ATCC 42265), Candida krusei (JCM 1609), Candida lusitaniae (ATCC 34449), Candida parapsdosis (JCM 1618), Trichosporon cutaneum (JCM 1462), Trichosporon asahii (JCM 1809), Cryptococcus neoformans (ATCC 32045), Aspergillus fumigatus (JCM 10253), Aspergillus niger (JCM 10254), Epidermophyton floccosum (ATCC 52063), Arthroderma otae (ATCC 28327), Arthroderma gypseum (ATCC 24163), Arthroderma benhamiae (ATCC 16781), Trichophyton rubrum (ATCC 10218), Trichophyton tonsurans (ATCC 10217), Trichophyton verrucosum (ATCC 28203), Trichophyton violaceum (ATCC 28944), Arthroderma vanbreuseghemii (ATCC 28145), Arthroderma incurvatum (ATCC 24005), or Trichophyton interdigitale (IFM 55365). |
| Claim: | 5. The method according to claim 1 , further comprising amplifying the nucleic acid in the sample by using a primer comprising tccgtaggtgaacctgcgg (SEQ ID NO. 4) and a primer comprising tcctccgcttattgatatgc (SEQ ID NO. 5). |
| Current U.S. Class: | 435/612 |
| Patent References Cited: | 5426027 June 1995 Lott et al. 5512446 April 1996 Miyazaki et al. 5631132 May 1997 Lott et al. 5645992 July 1997 Lott et al. 5658726 August 1997 Lemontt 5688644 November 1997 Lott et al. 5700647 December 1997 Miyazaki et al. 5846730 December 1998 Miyazaki et al. 6235890 May 2001 Morrison et al. 6420117 July 2002 Wessler et al. 6858387 February 2005 Smith et al. 7427472 September 2008 Lindsley et al. 7442510 October 2008 Miller et al. 7465543 December 2008 Page et al. 7598061 October 2009 Forsberg et al. 7906286 March 2011 Fukui et al. 2004/0076981 April 2004 Yoder et al. 2004/0241643 December 2004 Yamamoto et al. 2005/0053962 March 2005 Blackburn et al. 2005/0164243 July 2005 Smith et al. 2005/0227236 October 2005 Forsberg et al. 2007/0059693 March 2007 Miller et al. 2007/0134702 June 2007 Fukui et al. 2008/0113363 May 2008 Fukui et al. 2008/0113364 May 2008 Fukui et al. 2008/0113365 May 2008 Kuribayashi et al. 2008/0113366 May 2008 Kuribayashi et al. 2008/0124733 May 2008 Fukui et al. 2008/0161192 July 2008 Yoshii et al. 2008/0286791 November 2008 Tomatsu et al. 2008/0286792 November 2008 Tomatsu et al. 2008/0287312 November 2008 Tomatsu et al. 2008/0293061 November 2008 Tomatsu et al. 2008/0293062 November 2008 Tomatsu et al. 2008/0293063 November 2008 Tomatsu et al. 2008/0293064 November 2008 Tomatsu et al. 2008/0293065 November 2008 Tomatsu et al. 2008/0293066 November 2008 Tomatsu et al. 2008/0293067 November 2008 Tomatsu et al. 2008/0299569 December 2008 Tomatsu et al. 2008/0299570 December 2008 Tomatsu et al. 2008/0299571 December 2008 Tomatsu et al. 2008/0299572 December 2008 Tomatsu et al. 2008/0299573 December 2008 Tomatsu et al. 2008/0299574 December 2008 Tomatsu et al. 2008/0299575 December 2008 Tomatsu et al. 2008/0299576 December 2008 Tomatsu et al. 2008/0299577 December 2008 Tomatsu et al. 2008/0299578 December 2008 Tomatsu et al. 2008/0305488 December 2008 Tomatsu et al. 2009/0004659 January 2009 Tomatsu et al. 2009/0011419 January 2009 Tomatsu et al. 2009/0068661 March 2009 Tomatsu et al. 2009/0081666 March 2009 Fukui et al. 2009/0130667 May 2009 Fukui et al. 2009/0130668 May 2009 Kuribayashi et al. 2009/0130669 May 2009 Kuribayashi et al. 2009/0130670 May 2009 Yoshii et al. 2009/0130671 May 2009 Yoshii et al. 2009/0220972 September 2009 Fukui et al. 2009/0233282 September 2009 Tomatsu et al. 2009/0246775 October 2009 Kuribayashi et al. 2009/0298069 December 2009 Fukui et al. 2009/0305260 December 2009 Kuribayashi et al. 2009/0305262 December 2009 Kuribayashi et al. 2009/0305263 December 2009 Fukui et al. 2009/0317809 December 2009 Kuribayashi et al. 8-89254 April 1996 2003-501049 January 2003 2004-313181 November 2004 00/73499 December 2000 |
| Other References: | Leaw et al., “Identification of Medically Important Yeast Species by Sequence Analysis of the Internal Transcribed Spacer Regions,” Journal of Clinical Microbiology, Mar. 2006, vol. 44, No. 3, pp. 693-699. cited by examiner GenBank Accession No. AY207073, Jan. 2004, retrieved on-line [retrieval date, Sep. 9, 2011]. cited by examiner GenBank Accession No. AY207080, Jan. 2004, retrieved on-line [retrieval date, Sep. 9, 2011]. cited by examiner U.S. Appl. No. 12/294,915, filed Mar. 30, 2007, Applicants: Hideto Kuribayashi, et al. cited by applicant U.S. Appl. No. 12/295,277, filed Mar. 30, 2007, Applicants: Toshifumi Fukui, et al. cited by applicant U.S. Appl. No. 12/294,914, filed Mar. 30, 2007, Applicant(s): Toshifumi Fukui, et al. cited by applicant Blandin, et al., “Genomic Exploration of the Hemiascomycetous Yeasts: 16.Candida tropicalis”, FEBS Letters, vol. 487, 2000, pp. 91-94. cited by applicant Chen, et al., “Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts”, Journal of Clinical Microbiology, vol. 39, No. 11, Nov. 2001, pp. 4042-4051. cited by applicant Leaw, et al., “Identification of Medically Important Candida and Non-Candida Yeast Species by an Oligonucleotide Array,” Journal of Clinical Microbiology, vol. 45, No. 7, Jul. 2007, pp. 2220-2229. cited by applicant Jackson, et al., “Species Identification and Strain Differentiation of Dermatophyte Fungi by Analysis of Ribosomal-DNA Intergenic Spacer Regions”, Journal of Clinical Microbiology, vol. 37, No. 4, Apr. 1999, pp. 931-936. cited by applicant Leinberger, et al., “Development of a DNA Microarray for Detection and Identification of Fungal Pathogens Involved in Invasive Mycoses”, vol. 43, No. 10, 2005, pp. 4943-4953. cited by applicant |
| Primary Examiner: | Kim, Young J |
| Attorney, Agent or Firm: | Fitzpatrick, Cella, Harper and Scinto |
| رقم الانضمام: | edspgr.08568983 |
| قاعدة البيانات: | USPTO Patent Grants |
| الوصف غير متاح. |