Patent
Probe, probe set, probe carrier, and testing method
| العنوان: | Probe, probe set, probe carrier, and testing method |
|---|---|
| Patent Number: | 7,858,315 |
| تاريخ النشر: | December 28, 2010 |
| Appl. No: | 12/119999 |
| Application Filed: | May 13, 2008 |
| مستخلص: | A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 4 and mutated sequences thereof. |
| Inventors: | Tomatsu, Nobuhiro (Yokohama, JP); Fukui, Toshifumi (Yokohama, JP); Shimizu, Nobuyoshi (Sakura, JP); Takayanagi, Atsushi (Tokyo, JP) |
| Assignees: | Canon Kabushiki Kaisha (Tokyo, JP) |
| Claim: | 1. A probe set for detecting a DNA of Candida kefyr which is a pathogenic fungus, comprising four probes consisting of the following base sequences (1) to (4) respectively to specifically detect Candida kefyr: (1) gcggccagttcttgattctctgc (SEQ ID NO. 1) or the complementary sequence thereof; (2) agctcgtctctccagtggacataaac (SEQ ID NO. 2) or the complementary sequence thereof; (3) ttgaaagtggctagccgttgcc (SEQ ID NO. 3) or the complementary sequence thereof; and (4) tcgtggtaagcttgggtcatagagac (SEQ ID NO. 4) or the complementary sequence thereof. |
| Claim: | 2. A probe set for detecting a DNA of Candida kefyr which is a pathogenic fungus, comprising the following probes (A) to (D), wherein the probe set does not comprise another probe to detect Candida kefyr: (A) a probe consisting of gcggccagttcttgattctctgc (SEQ ID NO. 1); (B) a probe consisting of agctcgtctctccagtggacataaac (SEQ ID NO. 2); (C) a probe consisting of ttgaaagtggctagccgttgcc (SEQ ID NO. 3); and (D) a probe consisting of tcgtggtaagcttgggtcatagagac (SEQ ID NO. 4). |
| Claim: | 3. A kit for specifically detecting a DNA of Candida kefyr , comprising: the probe set according to claim 1 ; and a reagent for detecting a reaction of a probe with a target nucleic acid. |
| Claim: | 4. A kit for specifically detecting a DNA of Candida kefyr , comprising: the probe set according to claim 2 ; and a reagent for detecting a reaction of a probe with a target nucleic acid. |
| Current U.S. Class: | 435/6 |
| Patent References Cited: | 5512446 April 1996 Miyazaki et al. 5700647 December 1997 Miyazaki et al. 5846730 December 1998 Miyazaki et al. 6242178 June 2001 Lott et al. 6287779 September 2001 Engel et al. 6858387 February 2005 Smith et al. 7205111 April 2007 Christensen et al. 7442510 October 2008 Miller et al. 7498136 March 2009 Johnson 2004/0241643 December 2004 Yamamoto et al. 2005/0164243 July 2005 Smith et al. 2007/0059693 March 2007 Miller et al. 2007/0092944 April 2007 Leadlay et al. 2007/0134702 June 2007 Fukui et al. 2007/0238120 October 2007 Forsberg et al. 2008/0113363 May 2008 Fukui et al. 2008/0113364 May 2008 Fukui et al. 2008/0113365 May 2008 Kuribayashi et al. 2008/0113366 May 2008 Kuribayashi et al. 2008/0124733 May 2008 Fukui et al. 2008/0161192 July 2008 Yoshii et al. 2008/0286791 November 2008 Tomatsu et al. 2008/0286792 November 2008 Tomatsu et al. 2008/0287312 November 2008 Tomatsu et al. 2008/0293061 November 2008 Tomatsu et al. 2008/0293062 November 2008 Tomatsu et al. 2008/0293063 November 2008 Tomatsu et al. 2008/0293064 November 2008 Tomatsu et al. 2008/0293065 November 2008 Tomatsu et al. 2008/0293066 November 2008 Tomatsu et al. 2008/0293067 November 2008 Tomatsu et al. 2008/0299569 December 2008 Tomatsu et al. 2008/0299570 December 2008 Tomatsu et al. 2008/0299572 December 2008 Tomatsu et al. 2008/0299573 December 2008 Tomatsu et al. 2008/0299574 December 2008 Tomatsu et al. 2008/0299575 December 2008 Tomatsu et al. 2008/0299576 December 2008 Tomatsu et al. 2008/0299577 December 2008 Tomatsu et al. 2008/0299578 December 2008 Tomatsu et al. 2008/0305487 December 2008 Tomatsu et al. 2008/0305488 December 2008 Tomatsu et al. 2009/0004659 January 2009 Tomatsu et al. 2009/0011419 January 2009 Tomatsu et al. 8-89254 April 1996 2004-313181 November 2004 99/06596 February 1999 2004/061127 July 2004 |
| Other References: | Wadsworth, New York State Department, Mycology Proficiency Testing, Jun. 2002, printed pp. 1-42. cited by examiner Elie, Cheryl M et al, Journal of Clinical Microbiology, vol. 36(11), pp. 3260-3265, Nov. 1998, Rapid Identification of Candida species with Specifies specific DNA probes. cited by examiner U.S. Appl. No. 12/295,276, filed Mar. 30, 2007, Applicants: Hideto Kuribayashi, et al. cited by other U.S. Appl. No. 12/294,915, filed Mar. 30, 2007, Applicants: Hideto Kuribayashi, et al. cited by other U.S. Appl. No. 12/295,277, filed Mar. 30, 2007, Applicants: Toshifumi Fukui, et al. cited by other U.S. Appl. No. 12/295,273, filed Mar. 30, 2007, Applicants: Hideto Kuribayashi, et al. cited by other U.S. Appl. No. 12/294,910, filed Mar. 30, 2007, Applicants: Hideto Kuribayashi, et al. cited by other U.S. Appl. No. 12/294,914, filed Mar. 30, 2007, Applicant(s): Toshifumi Fukui, et al. cited by other U.S. Appl. No. 12/295,581, filed Mar. 30, 2007, Applicant(s): Hideto Kuribayashi, et al. cited by other U.S. Appl. No. 12/295,584, filed Mar. 30, 2007, Applicant(s): Toshifumi Fukui, et al. cited by other U.S. Appl. No. 12/295,583, field Mar. 30, 2007, Applicant(s): Toshifumi Fukui, et al. cited by other U.S. Appl. No. 12/295,579, filed Mar. 30, 2007, Applicant(s): Toshifumi Fukui, et al. cited by other U.S. Appl. No. 11/935,930, filed Nov. 6, 2007, Applicant(s): Hiroto Yoshii, et al. cited by other U.S. Appl. No. 11/935,807, filed Nov. 6, 2007, Applicant(s): Hideto Kuribayashi, et al. cited by other U.S. Appl. No. 11/935,789, filed Nov. 6, 2007, Applicant(s): Toshifumi Fukui, et al. cited by other U.S. Appl. No. 11/935,820, filed Nov. 6, 2007, Applicant(s): Hideto Kuribayashi, et al. cited by other U.S. Appl. No. 11/935,849, filed Nov. 6, 2007, Applicant(s): Hiroto Yoshii, et al. cited by other U.S. Appl. No. 12/120,172, filed May 13, 2008, Applicant(s): Nobuhiro Tomatsu, et al. cited by other U.S. Appl. No. 12/120,177, filed May 13, 2008, Applicant(s): Toshifumi Fukui, et al. cited by other U.S. Appl. No. 12/120,104, filed May 13, 2008, Applicant(s): Nobuhiro Tomatsu, et al. cited by other |
| Assistant Examiner: | Portner, Ginny |
| Primary Examiner: | Navarro, Mark |
| Attorney, Agent or Firm: | Fitzpatrick, Cella, Harper & Scinto |
| رقم الانضمام: | edspgr.07858315 |
| قاعدة البيانات: | USPTO Patent Grants |
| الوصف غير متاح. |