التفاصيل البيبلوغرافية
| العنوان: |
Active cytomegalovirus infection in critically ill immunocompeten patients admitted in the ICU. A molecular diagnosis approach |
| المؤلفون: |
Tania Tedjo Minuljo, Muhammad Hussein Gasem, Purnomo Hadi |
| المصدر: |
Journal of Biomedicine and Translational Research, Vol 3, Iss 1, Pp 1-4 (2017) |
| بيانات النشر: |
Diponegoro University, 2017. |
| سنة النشر: |
2017 |
| المجموعة: |
LCC:Medicine (General) |
| مصطلحات موضوعية: |
Medicine (General), R5-920 |
| الوصف: |
Active Cytomegalovirus (CMV) infection has been realated to immunocompromise conditions (malignancy, HIV-AIDS, longterm use of corticosteroids, transplant patient). Nowadays, severa studies have shown that immunocompetent critically ill patients were suffered from active CMV infection. Alteration of immune system in critically immunocompetent patient (without clear history of immunocompromise condition), might become the most possible reason enderlying this event. To document the prevalence of active CMV infection in critically ill immunocompetent patient; and to find out the difference in the degree of severity between groups of patients with and without active CMV infection, admitted in the ICU (Intensive Care Unit) . A cross sectional study was conducted from Appril 1st until June 30th 2013. Subjects were patient aged ≥ 14 years, hospitalized in ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients having a history of malignancy, HIV-AIDS, longterm use of corticosteroids, and receiving transplatation were excluded from the study. The degree of severity was calculated (using APACHE II score) in the first 24 hours in ICU. EDTA sample for qualitative PCR examination (procedure as described elsewhere) was collected after 4 days of treatment. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Finally, datas ware analyzed using bivariate analysis. From 50 subjects included, 16 patients had active CMV infection. The degree of severity due to APACHE II score were normally distributed with mean 11.8±6.43. The mean of APACHE II score in group with active CMV infection was higher than group without .tive CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510). The Prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in ICU of Dr. Kariadi Hospital Semarang and the degree of severity due to APACHE II score was higher in group with active CMV infection than group without active CMV infection. A qualitative PCR testing was useful in the diagnosis of active CMV among immunocompeten critically-ill patients in the ICU. Key Words: Immunocompetent, critically ill, active CMV infection, PCR |
| نوع الوثيقة: |
article |
| وصف الملف: |
electronic resource |
| اللغة: |
English |
| تدمد: |
2503-2178 |
| Relation: |
http://ejournal2.undip.ac.id/index.php/jbtr/article/view/866; https://doaj.org/toc/2503-2178 |
| DOI: |
10.14710/jbtr.v3i1.866 |
| URL الوصول: |
https://doaj.org/article/9a414f2b415f4da9a388aa46b6ff8358 |
| رقم الانضمام: |
edsdoj.9a414f2b415f4da9a388aa46b6ff8358 |
| قاعدة البيانات: |
Directory of Open Access Journals |